- About us
- Publications
- Scientific meetings
- Grants and funding
- Education and resources
- Policy
- Press centre
- Membership
- Public engagement
Proceedings of The Physiological Society
University of Oxford (2011) Proc Physiol Soc 23, PC356
Poster Communications
siRNA-mediated knockdown of caveolin-1 protein also reduces expression of cavin-1, but not flotillin-1, in cultured human smooth muscle.
A. Czajka2, J. Martin1, R. M. Tribe2, M. J. Taggart1
1. Institute of Cellular Medicine, Newcastle University, Newcastle upon Tyne, United Kingdom. 2. Division of Women's Health, Kings College London and King’s Health Partners, London, United Kingdom.
The spatial organisation of signal transduction pathways in mammalian cells is facilitated by discrete microdomains at the plasma membrane. Caveolae, Ω-shaped invaginations of the plasmalemma, are one such type of microdomain and their integrity has been proposed to be dependent upon a reciprocal expression of caveolin-1 and cavin-1 proteins [1, 2]. However, under certain settings, flotillins-1 and -2 also regulate the formation of flask-shaped invaginations [3]. Further uncertainty has arisen with a report in a human intestinal epithelial cell line that siRNA-mediated knock-down of flotillin-1 also down-regulated caveolin-1 protein expression [4]. In smooth muscle cells caveolae/Ω-shaped invaginations play an important role regulating contractile signalling pathways and as such, any inter-dependence of protein expression between caveolin-1, cavin-1 and flotillin-1 will have implications for the structural integrity and function of these microdomains. In human uterine smooth muscle cells we have investigated if systematic siRNA-mediated knockdown of each gene/protein of interest unveiled a co-dependent pattern of expression between these molecules. Myometrial cells were isolated from biopsies obtained, with written informed consent, from women undergoing elective Caesarean section and placed in culture before transfection with siRNA directed against caveolin-1 (2 sense sequences: 5’-CCAGAAGGGACACACAGUUUU [TT] and 5’-CAGGGCAACAUCUACAAGCUU [TT]), cavin-1 (sense: 5’-AGGAGAAGAUGGAGAAGAC[TT]), flotillin-1 (sense: 5'-AGAUGCACGGAUUGGAGAA[TT]) or scrambled siRNA control (5'- AGAGCGACUUUACACACUUU [TT]). Cells were lysed and processed for the assessment of mRNA (24 hours post-transfection) or protein (72-96 hours). Significant knockdown of mRNA, when compared to scrambled siRNA, occurred for each gene of interest (reduction to 17.55 + 8.59% for caveolin-1, n=9, mean+sem, unpaired t-test, P<0.05), to 15.25 + 4.35% for cavin-1 (n=5) and to 24.1 + 4.79% for flotillin-1 (n=9)). The mRNA knockdown remained gene-specific with no reciprocal effect on the other molecules. siRNA knockdown of caveolin-1 protein (to 20.6 + 4.33%, n=5) did not affect flotillin-1 but did also significantly reduce cavin-1 protein expression (to 46.6 + 13.0%, n=4). siRNA knockdown of cavin protein (to 52.82 + 13.73%, n=5) or flotillin protein (to 69.43 + 11.23%, n=4) did not affect the other proteins. These data indicate that in cultured human uterine smooth muscle cells, the siRNA-mediated knockdown of caveolin-1 protein also influences the degradation of cavin-1 protein, but not that of flotillin-1.
Where applicable, experiments conform with Society ethical requirements
