Myosin phosphatase is a type 1C protein phosphatase (PPP1c) that regulates muscle tone by dephosphorylating myosin light chains. Alternative splicing of a 31-nucleotide exonic segment from the 3′ end of the regulatory myosin phosphatase targeting (MYPT) subunit of the phosphatase generates either a leucine zipper positive (LZ+) or a leucine zipper negative (LZ-) isovariant with one suggested impact to be an alteration in the relaxatory sensitivity to activated protein kinase G[1-3]. There are five main gene-specific isoforms of MYPT with MYPT1, MYPT2 and MBS85 potentially being subjected to LZ+/LZ- alternative splicing. However, much of these data comes from animal studies. Although the nucleotide sequences for human MYPTLZ+ isovariants are publically accessible MYPTLZ- isovariants genomic sequences are not available. We therefore sought to examine MYPTLZ+ and LZ- expression in (i) human reference RNA (Clontech, 636538) (ii) human smooth muscle-specific RNA (Clontech, 636547); and (iii) RNA from human uterine tissue samples obtained following written informed consent from normal pregnant women undergoing elective Caesarean section at term. Myometrial fibres were microdissected free of all surrounding tissue, prior to RNA isolation and reverse transcription. To predict individual human MYPT1LZ- sequences, we aligned mouse (NM_027982) and chicken (NM_025132) MYPT1LZ- sequences with the known human MYPT1LZ+ sequence. The 31-nucleotide segment ‘GTGTCCGGCAAGAGTCAGTATCTTCTGGGCG’ was inserted at aligned sites deduced from the cross species alignment, generating in-frame putative human reads consistent with known chicken and mouse MYPTLZ- sequences. Exclusion of the 31-nucleotide sequence from the naturally occurring chicken and mouse MYPTLZ- sequences also resulted in LZ+ reads confirming that this was a conserved inter-species splicing mechanism. A similar approach was then taken with human MYPT2LZ+(NM_002481.3) and MBS85LZ+(NM_016706). PCR primers were designed to specifically recognize either the LZ+, or putative LZ- elements, for MYPT1, MYPT2 and MBS85 and amplicons assessed by SYBR-Green Quantitative PCR (50 cycles). Dissociation curve and agarose-gel electrophoresis analysis confirmed specific product amplicons for MYPT1LZ+ (27.9+0.04), MYPT2LZ+ (27.05+0.17), MBS85LZ+ (23.3+0.04) and MYPT1LZ- (25.20+0.17) primers in human smooth muscle RNA. The MBS85LZ- primer demonstrated a specific product with skeletal muscle cDNA (Primer Design UK; 31+0.28), however no convincing products were seen in the smooth muscle RNA samples. Our analyses confirm the 3′ exon-inclusion splicing of a MYPT1LZ- product in different human smooth muscle RNA. MBS85LZ- expression, although detected in human striated muscle, is low or absent in the human smooth muscle RNA pointing to tissue-specific MYPTLZ+/LZ- isoform expression patterns.