Inflammation of the peripheral tissues increases the responsiveness of the transient receptor potential vanilloid type 1 ion channel (TRPV1). TRPV1 sensitisation underlies the development of pain associated with inflammatory conditions at the periphery. Recent data show that TRPV1 is a homo- or heterotetramer, and that the TRPV1 splice variant, TRPV1b that could be a member of the heterotetrameric complex, produces a negative dominant effect on the responses of the ion channel. Here we studied inflammation mediators-induced transcriptional changes in TRPV1 and TRPV1b. Primary sensory neuronal cultures were prepared from dorsal root ganglia of Sprague-Dawley rats (80-100 grams) and kept either in the absence or presence of the inflammatory mediators, prostaglandin E2 (PGE2, 10µM) and bradykinin (BK, 10µM) for 2 days. The sensitising effects of the inflammatory mediators on TRPV1 was assessed by the cobalt uptake technique. Expression of TRPV1 and TRPV1b was studied by reverse transcription-polymerase chain reaction (RT-PCR). The primers covered a region from exon 6 to exon 8 of the rat TRPV1 mRNA (sense primer: 5’-TGGAGGTGGCAGATAACACA -3’, anti-sense primer: 5’ CCTTCCACAGGCCGATAGTA -3’). The PCR products were isolated and sequenced. Inflammation-induced chages in TRPV1 and TRPV1b expression was assessed by real-time quantitative RT-PCR (TRPV1 sense primer: 5’-CCTGCATTGACACCTGTGAA-3’ anti-sense primer 5’ – AGTCGGTTCAAGGGTTCCA-3’; TRPV1b sense primer: 5’- AGTGGGAAGATCGGGAACC-3’, anti-sense primer: 5’ – TCATATACAAGCAGTAAACGAAGAAG-3’). We found that 30nM capsaicin increased the proportion of responding cells from 1.4%±0.9% (n= 4) to 11.1±1.5% (n=4), and 1.9%±1.1% (n= 4) to 23.4±5.7% (n=4), in naive and inflamed cultures, respectively (mean±SEM). Washing the cultures for thirty minutes in PGE2- and BK-free medium produced only a small reduction in the relative number of capsaicin-responding neurons (2% (n=2) to 6.2% (n=2) and 1.2% (n=2) to 18.7% (n=2) in naive and inflamed cultures, respectively). The RT-PCR produced two amplicons, with ~500 and ~325 base pairs, respectively. Sequencing revealed that the larger product (502 base pairs) arose from the known rat TRPV1 sequence (NM_031982, NCBI). The smaller product had a size of 322 base pairs and was also derived from the TRPV1 gene. Alignment of the sequences of the two products revealed that the smaller product lacked 180 base pairs corresponding to a splice variant which joins exon 6 to 8, thereby lacking exon 7. Real-time quantitative RT-PCR showed that TRPV1 and TRPV1b were downregulated in the inflammatory conditions by 3 and 1.8 fold, respectively. These findings suggest that while in naive conditions TRPV1b behaves as a negative dominant regulator of TRPV1 responsiveness, this inhibitory effect could be ceased in inflammatory conditions.